site stats

Leguminosin group485 secreted peptide

NettetProtein Length: 94: SignalP D-value: 0.809: SSP Type: putative SSP: SSP Gene Family Name: Family_01: Putative SSP Family ID: Family_01: Annotation: leguminosin … NettetThe α-thymosins belong to a group of peptides isolated for the first time from calf thymus extracts, denominated Thymosin fraction 5 (TF5) (Goldstein, Guha, Zatz, Hardy, & …

Frontiers Small secreted peptides encoded on the wheat (Triticum ...

NettetThe insert in this plasmid (pENTR-STTM) was then LR recombined into pGWB402 destination vector 20 containing a 2X35S promoter driving the expression of the insert, and kanamycin-resistant marker (NOS promoter:NPTII:NOS 21 terminator) for selection. All constructs were confirmed by Sanger sequencing. 22 Small RNA northern blot. NettetProtein Length: 128: SignalP D-value: 0.631: SSP Type: putative SSP: SSP Gene Family Name: Family_01: Putative SSP Family ID: Family_01: Annotation: leguminosin group485 secreted peptide conf_class=HC differentiate adjective https://a1fadesbarbershop.com

assets.researchsquare.com

NettetGene ID: 11421172, updated on 20-Apr-2024 Summary Other designations proline-rich receptor-like protein kinase PERK2, leguminosin group485 secreted peptide NettetConsolidated transcript/protein view: LotjaGi2g1v0278000.1 is a Leguminosin group485 secreted peptide; TAIR: AT5G09520.1 hydroxyproline-rich glycoprotein family protein; … NettetLegend: 6w mi482 Ri vs 6w WT Si: 6 week after infection mi482 resistant inocultated with Phytophthora infestans vs wildtype susceptible inoculated 6w mi2118b Ri vs 6w WT Si: 6 wee format powerpoint folien ändern

Frontiers Small secreted peptides encoded on the wheat (Triticum ...

Category:MtSSPdb: Medicago truncatula SSP Database

Tags:Leguminosin group485 secreted peptide

Leguminosin group485 secreted peptide

(PDF) S4 Table - ResearchGate

NettetNascent polypeptide-associated complex subunit beta-SL3.0ch04: 2663576 - 2668939: 2668940 - 2671940: Solyc04g009170.2: RING/U-box superfamily protein + SL3.0ch04: 2671541 - 2676566: 2668540 - 2671540: Solyc04g009180.2: TCP transcription factor 14 + SL3.0ch04: 2686905 - 2688461: 2683904 - 2686904: Solyc04g009190.3: UPF0664 … NettetLeguminosin group485 secreted peptide; TAIR: AT5G09520.1 hydroxyproline-rich glycoprotein family protein; Swiss-Prot: sp P27951 BAG_STRAG IgA FC receptor; …

Leguminosin group485 secreted peptide

Did you know?

NettetLOC11425580 abscisic acid and environmental stress-inducible protein [ (barrel medic)] Gene ID: 11425580, updated on 15-Feb-2024 Summary Other designations abscisic … NettetLOW QUALITY:Leguminosin group485 secreted peptide (AHRD V3.3 *** A0A072V4P7_MEDTR) Alba DNA/RNA-binding protein (AHRD V3.3 *** AT2G34160.1) expansin B3 (AHRD V3.3 *** AT4G28250.1) O-methyltransferase (AHRD V3.3 *** A0A1B4Z3W3_9ROSA) R2R3MYB transcription factor 63 MYB

NettetLeguminosin group485 secreted peptide; TAIR: AT5G09520.1 hydroxyproline-rich glycoprotein family protein; Swiss-Prot: sp P27951 BAG_STRAG IgA FC receptor; … NettetNational Center for Biotechnology Information

NettetLeguminosin group485 secreted peptide, G7IPN6_MEDTR AT30 CATGAGGCGTCCGTCGTTATGGAACT See AS40 5.06 65873 263 Uncharacterized protein, I1KG32_SOYBN NettetMTR_5g077315 leguminosin group485 secreted peptide [ (barrel medic)] Gene ID: 25494874, discontinued on 19-Apr-2024. Summary. Gene provides a unified query …

http://prgdb.org/prgdb4/expression/Canto-Pastor%C2%A0et%C2%A0al.,%202424

NettetLegumin is a conjugated protein with six subunits. The individual subunits have a hydrophilic α chain that is initially linked to the smaller hydrophobic β chain with a … differentiate administration and supervisionNettetGene provides a unified query environment for genes defined by sequence and/or in NCBI's Map Viewer. LOC25488434 cuticle collagen 2 [ (barrel medic)] Gene ID: … format powershell commandlet outputNettet27. aug. 2010 · We identify a family of functionally redundant homologous peptides that are secreted, tyrosine-sulfated, and expressed mainly in the stem cell area and the innermost layer of central columella cells. We name these peptides root meristem growth factors (RGFs). differentiate adt and ds